Deadline to apply is March 21. The program runs from late May to September 2025 and requires in-person event attendance.

Related: The Massive Thrift Store in Virginia that Takes Nearly All Day to Explore For collectors, it occasionally yields vintage items that have appreciated significantly in value. For everyone, it ...

While previous studies say volcanic or atmospheric lightning may have triggered chemical reactions that created organic ...

The 7-foot, 8-inch former Virginia cop and Harlem Globetrotter known as a “gentle giant” has died at his family home North ...

The U.S.-funded broadcaster’s suit mirrors an argument raised by USAID workers who successfully challenged the Trump ...

JUPITER, Fla., March 20, 2025is the latest name generating buzz, claiming to "awaken a dormant metabolism" and provide ...

See the full list in our City Dating Guide below. City Dating Guide: The Top Places To Meet a Match In Person Q: Where did you meet your significant other? Results reflect percentages of ...

Advanced nuclear firm Oklo has signed an Interface Agreement (IAG) with Idaho National Laboratory (INL), marking a key ...

Using RT–PCR, we amplified seven overlapping fragments covering the ORF of MUL with the following primers: 1F, 5′–AGGCAATGGATGAACAGAGC–3′, 1R, 5′–TGGTGAGACTGCAGAGTTGAA–3′ (261-bp ...

Can Max Verstappen defend his title? Are McLaren going to continue their impressive form from the second half of last season? Will Mercedes return to the top? Are Ferrari capable of making the ...